Abstract

Objective: Topical pretreatment with all-transretinoic acid (atRA) is known to improve healing of cutaneous
wounds. We tested the effect of atRA on wound healing of genetically diabetic db/db mice. It is known
that cutaneous wounds of db/db mice show delayed wound healing due to impaired wound contraction, delayed
granulation tissue formation and underexpression of keratinocyte growth factor (KGF). Methods: 0.1%
atRA in 100 mg aqueous gel was applied to the back skin of db/db mice as well as to their normal heterozygous
littermates, db/+ mice, for five consecutive days, and 2 days after completion of the atRA treatment, two
round excisional wounds were created down the panniculus carnosus with a 6-mm punch biopsy on the back
skin of each mouse. Results: After 5 days treatment with 0.1% atRA, significant hypertrophy of the epidermis
and dermis, neovascularization, and inflammatory cell invasion were seen in the skin of the db/db mice, but
these effects were seen only weakly in db/+ mice. Wounds in atRA-treated db/db mice closed more rapidly
than those in vehicle-treated db/db mice. KGF mRNA expression, which is usually significantly lower
in db/db mice than in normal mice, in wounds of atRAtreated db/db mice on day 1 of treatment was as strong
as in db/+ mice. Conclusion: Pretreatment with atRA reversed the impaired wound healing in db/db mice.

Introduction

Retinoic acid (RA) improves the clinical symptoms of acne vulgaris, psoriasis and skin photoaging [1]. Histologically,
topical treatment with RA induces hypertrophy in the epidermis and dermis via an increase in dermal vasculature
and invasion of inflammatory cells. RA has several contradictory effects on wound healing. For example, systemic
application of RA has deleterious effect on healing of fullthickness skin wounds and corneal wounds of diabetic animals
[2, 3]. On the other hand, systemic RA reverses delayed wound healing in steroid-treated animals [4-7]. RA
is also known to improve wound healing of abraded skin by acceleration of epidermal turnover when it is applied topically
prior to wounding [8]. Topical pretreatment with RA also enhances healing of full-thickness excisional wounds
of photoaged and normal skin [9, 10]. These results suggest that wound healing may be affected by the route or
schedule of retinoid administration, and that, at least in some skin conditions, topical pretreatment may be the most
effective method of administration of all-trans-RA (atRA). We hypothesized that impaired wound healing of genetically
diabetic db/db mice may be reversed by topical pretreatment with atRA. Db/db mice show clinical symptoms
similar to insulin-resistant diabetes mellitus patients, such as severe obesity, hyperglycemia, hyperinsulinemia, and
insulin resistance [11-14]. These symptoms were derived from genomic mutation in the leptin receptor. Db/db mice
are also known to show impaired cutaneous wound healing, as is universally observed in diabetic patients [11]. Wound
healing of db/db mice is characterized by weak contraction, slow inflammatory cell invasion and delayed granulation
formation. The characteristic anatomy of the skin of db/db mice, including thick subdermal fat and an extremely thin
dermis, may also contribute to impairment of wound healing. Many growth factors and their receptors, such as FGF,
FGF receptors, KGF, IGF and VEGF, have been found to be aberrantly expressed in wounds of db/db mice [11, 12].
Of these, the factor that is considered to be the most important for delayed wound healing in db/db mice is KGF
[15]. In normal mice, the mRNA levels of KGF are acutely upregulated early in wound healing [16, 17]. However,
KGF mRNA levels in db/db mice are unchanged throughout the healing process [15]. Since upregulation of KGF
mRNA is one of the earliest events of wound healing, KGF is considered to be an important factor that might regulate
downstream events during wound healing.

Materials and methods

Animals
Female C57BLK/ksj db/db mice at 8-12 weeks of age (Saitama Experimental Animals Supply Company, Saitama, Japan) and their
normal littermates (db/+ mice) were used throughout this study. Animal experiments were performed according to the Laboratory
Animal Guidelines of Tokyo University. All animal procedures were performed under general anesthesia with diethyl ether. Three independent
experiments were performed, and 12 to 15 mice were used in each experiment. The back skin of each mouse was shaved and
topically treated for five consecutive days with 100 mg 0.1% atRA (Sigma Aldrich, Tokyo, Japan) in aqueous gel vehicle or 100 mg
aqueous gel without atRA. Scaling was graded by three investigators according to the visual scoring method of Effendy et al. [18]:
0, no scaling; 1, weak scaling; 2, moderate scaling; 3, large flakes, intense peeling.
On the 2nd day after completion of atRA treatment, two 6-mm round excisional wounds, down the panniculus carnosus and its associated
fascia, were created in each mouse. The wound area was calculated as the product of the long and short diameters of each
wound. Mice were killed on days 1, 3, 7 and 14 by cervical dislocation under general anesthesia with diethyl ether. Wound tissue
was processed for histology and RT-PCR.

Histology
The mice were injected subcutaneously with 30 μg/g 5-bromo-2-deoxyuridine (BrdU labeling reagent; Amersham Pharmacia, Shinjuku,
Tokyo) 3 and 24 h before they were killed. Skin samples were fixed in 10% formalin, dehydrated and embedded in paraffin.
Paraffin sections were cut at a thickness of 5 μm. Sections were rehydrated and stained with hematoxylin and eosin, and with Gomori's
trichrome stain. Immunohistochemistry to determine the level of BrdU incorporation into cells was performed as follows. Sections
were incubated in 4 N HCl for 30 min at 37 °C followed by 0.1 M borax buffer, pH 9.0, for 10 min at room temperature. The specimens
were then treated with anti-BrdU monoclonal antibody (Amersham Pharmacia) followed by biotinylated anti-mouse IgG.
The specimens were then incubated in ABC reagent (Vector, Burlingame, Calif.), and developed with 3,3′-diaminobenzidine.

RT-PCR
mRNA was extracted from a 2-mm wound margin using ISOGEN LS (Nippon Gene, Shinjuku, Tokyo). The mRNA (1 μg in a total
volume of 20 μl) was transcribed to cDNA by AMV reverse transcriptase (Promega Japan, Higashinihonnbashi, Tokyo) at 37°C
for 1 h. For semiquantitative detection of KGF and β-actin cDNA, 1 μl cDNA in a total volume of 50 μl (50 mM KCl, 15 mM Tris-
HCl, pH 8.0, 4 mM MgCl2) was amplified with Ampli-Taq Gold (PE Biosystems, Roppongi, Tokyo) in a PC-960G thermal cycler
(Cosmo Bio, Toyo, Tokyo). The sequences of the oligonucleotide primers used for amplification of KGF were TTGCAATGAACAAGGAAGGA
and GAATTCTATCTTGCAATGAA, and those for β-actin were TGAGGAGCACCCTATGCTGC and TAGCCCTCGTAGATGGG.
Amplification was carried out as follows: pre-PCR step of 10 min at 94 °C; 32 PCR cycles of 30 s at 94 °C, 30 s at
58 °C and 1 min at 72 °C; and a final step of 10 min at 72°C. We had already confirmed in a preliminary study that the PCR products
would be within the linear log phase under these conditions.

Results

The effects of topical application of atRA
Scaling was more intense in db/db mice than in db/+ mice following treatment with 0.1% atRA (Fig. 1). Although
0.1% atRA did not induce significant scaling in db/+ mice, higher concentrations of atRA did induce significant scaling
in these mice, so the effect of atRA appears to be dose-dependent. Histologically, the skin of db/+ mouse showed only
slight dermal and epidermal hypertrophy after treatment with 0.1% atRA. On the other hand, the skin of atRAtreated
db/db mice showed significant hypertrophy of epidermis and dermis, scaling of stratum corneum, an increase
in cellularity and proliferation of subepidermal vessels (Fig. 2). Elongation of the rete ridges and atrophy
of the sebaceous glands were also characteristic of atRAtreated db/db mice. In vehicle-treated db/db mice, BrdU incorporation
was observed throughout the basal layer of the epidermis. However, in atRA-treated db/db mice, BrdU
incorporation was greater in the follicular epidermis, but not in the interfollicular epidermis (Fig. 3).
Wound healing of atRA- and vehicle-treated db/db mice

Day 0 after wounding
The wounds in vehicle-treated db/db mice were 20-30% larger than the original wounds, but the wounds in atRAtreated
db/db mice did not show enlargement just after wounding (Fig. 4).

Day 1 after wounding
Vehicle-treated db/db mice on day 1 after wounding showed only a small number of inflammatory cells in the
wound cleft. Only a small amount of extracellular matrix had formed at this time. However, atRA-treated db/db mice
on day 1 showed massive invasion of inflammatory cells in the wound cleft. In addition, a large amount of extracellular
matrix staining bluish with trichrome reagent had formed within the granulation tissue, which connected the
granulation tissue with the wound margin (Fig. 5a, b).

Day 14 after wounding
Macroscopically, 78% of wounds in vehicle-treated db/db mice had not closed on day 14. Histologically there was a
large amount of granulation tissue within the wide wound cleft. Epidermal regeneration had started, but due to the
distance between the wound margins, there still was an uncovered area within the cleft. On the other hand, 89% of
the wounds in atRA-treated db/db mice had already closed by this time. Histologically the wound margins had come
close to each other, and reepithelialization was almost complete (Fig. 5c, d).

Expression of KGF mRNA
mRNA expression of KGF at the time of wounding did not show significant differences between atRA- and vehicletreated
db/db mice (data not shown). However, KGF mRNA in the wounds of atRA-treated db/db mice on day 1
after wounding was significantly higher than in vehicleor sodium lauryl sulfate-treated db/db mice (Fig. 6).

Discussion

In the study reported here we demonstrated that (1) topical treatment with atRA had stronger effects in db/db mice
than in db/+ mice, and that (2) atRA pretreatment reversed delayed wound healing in db/db mice.
It is noteworthy that atRA induced cutaneous changes in db/db mice much more strongly than in db/+ mice. This
does not mean that db/+ mice are totally refractory to the effects of atRA, but that db/db mice are more sensitive to
atRA than db/+ mice, because the latter showed effects similar to those seen in db/db mice when they were treated with
higher concentrations of atRA. It is not clear whether this increased sensitivity was due to downstream events resulting
from the leptin receptor deficiency, or due to loss of barrier function. Similar model-specific sensitivity has
been observed in other experiments. For example, atRA increases the synthesis of collagen and hyaluronic acid in
UVB-irradiated mice, but not in non-irradiated hairless mice [19, 20]. It has also been reported that atRA effectively
reverses steroid-retarded repair, which may be a result of a mutual interaction between glucocorticoids and
retinoids in the process of inflammation, immunity and connective tissue production [4-7]. It is interesting that
the sebaceous glands of db/db mice showed extremely strong changes. Sebaceous glands almost completely disappeared
in db/db mice after treatment with 0.1% atRA, but those in db/+ mice did not show significant changes
after the same treatment. Even with 0.4% atRA, about 30% of sebaceous glands remained intact in db/+ mice, although
significant dermal hypertrophy was observed with this concentration of atRA.
Pretreatment with 0.1% atRA had little effect on the wound healing in normal mice, but it significantly accelerated
wound healing in db/db mice. This may reflect the biological effects of atRA pretreatment in these animals. Delayed
wound healing in db/db mice seemed to be enhanced by treatment with atRA. First, full-thickness wounds in
db/db mice had enlarged 20-40% just after wounding due to their extremely thin dermis with a small amount of extracellular
matrix, which was the primary cause of delayed wound healing in db/db mice during the early stages of
wound healing. Treatment with atRA made the dermis thick and stiff preventing enlargement of excisional wounds in
db/db mice. Second, granulation tissue and extracellular matrix formation induced by atRA may also accelerate
wound healing in db/db mice. This granulation tissue contains huge numbers of inflammatory cells that release cytokines
and growth factors that enhance wound healing. In addition, smooth muscle actin fiber involved in wound
granulation may exert a contractile force. The mechanism of action of atRA in wound healing is
complicated. A study using a dominant-negative retinoic acid receptor mutant strongly indicates that epidermal proliferation
and regeneration is initiated by heparin-binding epidermal growth factor (HB-EGF) induced by atRA [21,
22]. Since atRA induction of HB-EGF occurs in suprabasal cells prior to the onset of basal cell hyperproliferation, this
mechanism may well explain the effectiveness of atRA pretreatment. On the other hand, atRA may also enhance
macrophage function, and thus finally may enhance macrophage-derived growth factors such as FGF, TGF and IGF-I
[6]. This is also plausible since macrophage dysfunction is seen in db/db mice [23]. A more sensitive real-time RT-PCR
could detect quantitative differences in these macrophagederived growth factors.
Although suppression of KGF is characteristic of wound healing in db/db mice, KGF mRNA levels in unwounded
skin are almost the same between db/db and db/+ mice [20], which was also confirmed by our RT-PCR (data not shown).
In addition, atRA-induced epidermal proliferation in db/db mouse was not associated with KGF upregulation before
wounding. Taken together, atRA does not directly induce KGF in unwounded skin but it causes the skin of db/db
mice to induce KGF. Previous studies of atRA application to already existing
wounds have revealed conflicting results. Some investigators have shown enhanced healing [7, 14, 24], but others
have shown retardation of healing [10, 25, 26]. On the other hand, topical pretreatment with atRA has consistently
shown improvement in wound healing. In addition, our experimental and clinical experience has revealed that atRA
worsens wound healing of full-thickness open wounds (unpublished data). For these reasons we do not recommend
atRA application to diabetic ulcers. In practice, atRA may enhance wound healing when it is applied before surgery
in diabetic patients. In the present study, we only evaluated the effects of atRA pretreatment in diabetic wounds,
but it may be possible to apply this strategy to other healing-impaired wounds, such as those in the skin of the elderly
or malnourished, or ischemic skin. Pretreatment with atRA may prevent delayed healing, infection and dehiscence
in these potentially healing-impaired wounds.

Fig. 1 Scaling score of db/db mice treated with 0.1% atRA, and of db/+ mice treated with 0.1% or 0.4% atRA. Three
mice in each group were evaluated. The values are means ± SD of duplicate measurements
from three independent experiments.

Fig. 2a-d H&E staining of the back skin of db/+ mice (a vehicletreated mouse, b 0.1% atRA-treated mouse) and db/db mice (c vehicle-
treated mouse, d 0.1% atRA-treated mouse). Arrows indicate sebaceous glands.

Fig. 3a-d BrdU staining of back skin of db/db mice treated with either of vehicle (a) or 0.1% atRA (b) for 5 days. c, d High-power
magnification of a and b (a, b ×100; c, d ×200)

Fig. 4 Wound area of db/+ and db/db mice. Round wounds of diameter 6 mm were made on the back skin of mice pretreated
with either 0.1% atRA or vehicle. Wounds of db/+ mice had almost closed by day 7 whether they had been treated
with 0.1% atRA or vehicle. On the other hand, vehicle-treated db/db mice showed enlargement
of the wound area on day 1, which was followed by delayed wound contraction. Pretreatment with atRA prevented
the wounds of db/db mice from expanding, which may have contributed to the earlier wound closure. Data represent
means ± SD of duplicate measurements from three independent experiments.

Fig. 5a-c Wound sections of db/db mice pretreated with vehicle (a, c) or atRA (b, d) were stained with Gomori's trichrome. Arrows
indicate the wound margin (a, b 1 day after wounding; c, d 14 days after wounding). a, b ×200; c, d ×50

References
1. Zouboulis ChC, Orfanos CE (2000) Retinoids. In: Millikan LE
(ed) Drug therapy in dermatology. Marcel Dekker, New York
Basel, pp 171-233
2. Frosch PJ, Czarnetzki BM (1989) Effect of retinoids on wound
healing in diabetic rats. Arch Dermatol Res 281:424-426
3. Hatchell DL, Ubels JL, Stekiel T, Hatchell MC (1985) Corneal
epithelial wound healing in normal and diabetic rabbits treated
with tretinoin. Arch Ophthalmol 103:98-100
4. Wicke C, Halliday B, Allen D, Roche NS, Scheuenstuhl H,
Spencer MM, Roberts AB, Hunt TK (2000) Effects of steroids
and retinoids on wound healing. Arch Surg 135:1265-1270
5. Anstead GM (1998) Steroids, retinoids, and wound healing.
Adv Wound Care 11:277-285
6. Hunt TK (1986) Vitamin A and wound healing. J Am Acad
Dermatol 15:817-821
7. Hunt TK, Ehrlich HP, Garcia JA, Dunphy JE (1969) Effect of
vitamin A on reversing the inhibitory effect of cortisone on healing
of open wounds in animals and man. Ann Surg 170:633-641
8. Mandy SH (1986) Tretinoin in the preoperative and postoperative
management of dermabrasion. J Am Acad Dermatol 15:
878-879, 888-889
9. Popp C, Kligman AM, Stoudemayer TJ (1995) Pretreatment of
photoaged forearm skin with topical tretinoin accelerates healing
of full-thickness wounds. Br J Dermatol 132:46-53
10. Klein P (1975) Vitamin A acid and wound healing. Acta Derm
Venereol Suppl (Stockh) 74:171-173
11. Greenhalgh DG, Sprugel KH, Murray MJ, Ross R (1990)
PDGF and FGF stimulate wound healing in the genetically diabetic
mouse. Am J Pathol 136:1235-1246
520
Fig. 6 Expression of KGF mRNA in day 1 wounds of db/db and
db/+ mice treated with atRA (RA), sodium lauryl sulphate (SLS), or
vehicle (V). A representative result of RT-PCR from three independent
experiments is shown (KGF KGF mRNA, BA β-actin mRNA)
12. Tsuboi R, Rifkin DB (1990) Recombinant basic fibroblast
growth factor stimulates wound healing in healing-impaired
db/db mice. J Exp Med 172:245-251
13. Chen H, Charlat O, Tartaglia LA, Woolf EA, Weng X, Ellis SJ,
Lakey ND, Culpepper J, Moore KJ, Breitbart RE, Duyk GM,
Tepper RI, Morgenstern JP (1996) Evidence that the diabetes
gene encodes the leptin receptor: identification of a mutation in
the leptin receptor gene in db/db mice. Cell 84:491-495
14. Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh
JG, Lee JI, Friedman JM (1996) Abnormal splicing of the leptin
receptor in diabetic mice. Nature 379: 632-635
15. Werner S, Peters KG, Longaker MT, Fuller-Pace F, Banda MJ,
Williams LT (1992) Large induction of keratinocyte growth
factor expression in the dermis during wound healing. Proc Natl
Acad Sci U S A 89:6896-6900
16. Werner S, Breeden M, Hubner G, Greenhalgh DG, Longaker
MT (1994) Induction of keratinocyte growth factor expression
is reduced and delayed during wound healing in the genetically
diabetic mouse. J Invest Dermatol 103:469-473
17. Nakagawa K, Zhang Y, Tsuji H, Yoshizumi M, Kasahara T,
Nishimura H, Nawroths PP, Nakagawa M (1998). The angiogenic
effect of tissue factor on tumors and wounds. Semin
Thromb Hemost 24:207-210
18. Effendy I, Weltfriend S, Kwangsukstith C, Singh P, Maibach
HI (1996) Effects of all-trans retinoic acid and sodium lauryl
sulphate on the permeability of human skin in vitro. Br J Dermatol
135:428-432
19. Margelin M, Medaisko C, Lombard D, Picard J, Fountanier A
(1996) Hyaluronic acid and dermatan sulfate are selectively
stimulated by retinoic acid in irradiated and nonirradiated hairless
mouse skin. J Invest Dermatol 106:505-515
20. Varani J, Fisher GJ, Kang S, Voorhees JJ (1998) Molecular
mechanisms of intrinsic skin aging and retinoid-induced skin
repair. J Invest Dermatol Symp Proc 3:57-60
21. McCarthy DW, Downing MT, Brigstock DR, Luquette MH,
Brown KD, Abad MS, Besner GE (1996) Production of heparin-
binding epidermal growth factor (HB-EGF) at sites of
thermal injury in pediatric patients. J Invest Dermatol 106:49-
56
22. Xiao JH, Feng X, Di W, Peng ZH, Li LA, Chambon P, Voorhees
JJ (1999) Identification of heparin-binding EGF-like growth factor
as a target in intercellular regulation of epidermal basal cell
growth by suprabasal retinoic acid receptors. EMBO J 18:1539-
1548
23. Zykova SN, Jenssen TG, Berdal M, Olsen R, Myklebust R,
Seljelid R (2000) Altered cytokine and nitric oxide secretion in
vitro by macrophages from diabetic type II-like db/db mice. Diabetes
49:1451-1458
24. Herrmann JB, Woodward SC (1972) An experimental study of
wound healing accelerators. Am J Surg 38:26-34
25. Hung VC, Lee JY, Zitelli JA, Hebda PA (1989) Topical tretinoin
and epithelial wound healing. Arch Dermatol 125:65-69
26. Watcher MA, Wheeland RG (1989) The role of topical agents
in the healing of full-thickness wound. J Dermatol Surg Oncol
15:1188-1195
521