|
Abstract
Keloids are skin abnormalities that are characterized
by excessive deposition of collagen bundles in
the dermis. Patients with keloids complain not
only about their cosmetic appearances, but also
about continuous itching and/or tenderness associated
with chronic inflammation. Degradation of extracellular
matrix (ECM) may be upregulated associated with
the expansion of keloids into circumferential skin,
and high metabolic activity of keloid tissues may
be due to increased matrix metalloproteinases (MMPs)
activity. Based on these hypotheses, we examined
differences in expressions of MMP-1, MMP-8, and
MMP-13 between keloid-derived fibroblasts and normal
dermal fibroblasts. Since retinoids are potent
inhibitors of MMPs in the treatment of photoaged
skin and cancers, we also examined whether or not
tretinoin affects MMPs expressions of keloid-derived
fibroblasts.
The results of real-time PCR and ELISA demonstrated
a significant upregulation of MMP-13 as well as significant
downregulation of MMP-1 and MMP-8 in keloid-derived
fibroblasts, both at mRNA and protein levels. MMP-1
mRNA expression in the control group was significantly
upregulated after the addition of tretinoin, whereas
no significant change was observed in the keloid group.
MMP-8 mRNA expression in the control group was significantly
upregulated with the peak at 12 hours by tretinoin,
while no significant change was observed in the keloid-derived
fibroblasts. In contrast, the remarkably elevated MMP-13
mRNA expression in the keloid group was significantly
suppressed with the peak suppression at 12 hours after
addition of tretinoin, while MMP-13 mRNA expression
in the control group was not significantly changed.
The decrease in MMP-1 and MMP-8 may contribute to accumulation
of type I and type III collagen in keloid tissues,
and this mechanism may be modulated by molecular interaction
with MMP-13. Tretinoin appeared to reverse the abnormal
expression profile of MMPs in keloid-derived fibroblasts,
such as markedly elevated expression of MMP-13, partly
through inactivation of AP-1 pathway. The present results
suggested that tretinoin may be clinically useful to
improve chronic inflammation seen in keloids and prevent
expansion of keloid tissues into circumferential normal
skin.
Introduction
Keloids are skin abnormalities that are characterized
by excessive deposition of collagen bundles in the
dermis. In keloids, the normal wound healing process
is derailed from the normal, resulting in impairment
of the balance bewteen production and degradation of
extracellular matrix (ECM), such as collagens (1).
Since fibroblasts play a leading part in production
of ECMs, it is thought that there is a difference in
the cellular function between keloid-derived fibroblasts
and normal ones. However, accumulating data have shown
that there is no significant difference in culture
growth, cell size, population density, and karyotype
between these (2).
During normal wound repair, type III collagen appears
at day 2 to 3, followed by type I collagen at day 6
to 7 (3). The total amount of type I and III collagen
increases over time, whereas the proportion of type
III collagen decreases from 60 % at 1 week after wounding,
to 28 % in the mature scar (4). In keloids, however,
the relative amount of type III collagen remains high
compared to normal scars or normal skin (5). The ratio
of α-1(I)-procollagen (a precursor of type I collagen)
mRNA to α-1(III)-procollagen (a precursor of type III
collagen) mRNA is markedly elevated in keloid-derived
fibroblasts compared to that in normal-tissue-derived
fibroblasts in vitro (6). The same tendency is also
observed in keloid tissues in vivo (7). There seems
to be a discrepancy between excessive accumulation
of type III collagen in keloid tissues and an elevated
mRNA level of type I procollagen in biosynthesis, which
remains unknown. This discrepancy is explicable if
cytologic aberrations occur at the level of the degradation
of collagen fibers, especially type III collagen. However,
past studies have only shown a normal (8), decreased
(9), increased (10) collagenase activity (more accurately,
degradation activity of type I collagen), and no studies
have demonstrated altered expression of each type of
collagenase in keloid tissues or keloid-derived fibroblasts.
Currently, collagenases are categorized into groups
of endopeptidases with a divalent Zn2+ at the active
site involved in ECM remodeling, matrix metalloproteinases
(MMPs). MMP-1 (also known as interstitial collagenase
or collagenase 1), MMP-8 (neutrophil collagenase, collagenase
2), and MMP-13 (collagenase 3), are the only mammalian
enzymes recognized for their unique ability to cleave
the triple helical domain of fibrillar collagen types
I, II, and III (11). However, each collagenase differs
in the extent to which it cleaves these fibrillar collagen
subtypes in vitro. MMP-1 preferentially degrades type
III collagen, whereas MMP-8 has its greatest activity
on type I collagen (12). Neither MMP-1 nor MMP-8 appears
to have any significant activity against type II and
IV collagen. MMP-13 is the most recently discovered
human collagenase, which can degrade all fibrillar
collagen subtypes with almost equal efficacy, and is
the only collagenase with significant activity against
type II and IV collagen (13).
Before establishing novel classification of collagenases
as descrived above, fibroplastic lesions due to deposition
of ECM such as collagen fibers had been classified
into two groups; increased-level group and decreased-level
group, according to their collagenase activities. Rheumatoid
arthritis, osteoarthritis, periodontal diseases, otitis
media cholesteatoma, and malignant tumors belong to
the former, while pulmonary fibrosis, hepatic fibrosis,
hepatic cirrhosis, and systemic sclerosis belong to
the latter (11). We thought that, to decide the direction
of treatment for keloids, it was essential to determine
whether keloids belong to the former group or the latter
one. The activity of MMPs is regulated at the three
levels; transcription, zymogen activation, and inhibition
of proteolytic activity (11). As for the regulations
at the level of transcription, most MMPs are induced
through activation of nuclear AP-1 transcription factor
(14-16). The AP-1-dependent activation of inducible
MMPs is potently inhibited by glucocorticoids (17)
and retinoids (18) at the transcriptional level. With
regard to the regulations at the level of extracellular
zymogen activation, latent precursors or zymogens of
most MMPs are proteolytically activated via exposure
of the catalytic site (19). As for the regulations
at the level of inhibition of proteolytic activity,
non-specific inhibitors, such as α2-macroglobulin and
α1-antiprotease, as well as specific inhibitors, tissue
inhibitors of metalloproteinases (TIMPs), are responsible
for the inhibition (20).
It was reported that MMP-1 and MMP-8 activities were
upregulated in photoaging skin by repeated exposure
to ultraviolet irradiation (21, 22). However, tretinoin
(all-trans retinoic acid) suppressed upregulated MMP-1
in photoaging skin at the level of transcription, probably
via anti-AP-1 effects (23).
The activity of MMPs is also intimately correlated
with the invasive or metastatic ability of malignant
tumor cells (24, 25). Especially for skin malignancies,
degradation of ECM is the first step to local invasion
and metastasis. Thus, basic and clinical studies have
been performed with the aim of chemoprevention of ECM
degradation in malignant melanoma, basal cell carcinoma,
and squamous cell carcinoma (26-28), as well as chemoprevention
of cell growth. Retinoids are the subject of increasing
interest as an effective means to control upregulated
MMPs activity of malignant tumor cells and inhibit
the advancement of tumors (27). It has been reported
that retinoids suppress MMP-1 and MMP-8 activity in
these malignant tumor cells in vitro (28).
Thus, we hypothesized that degradation of ECM may be
upregulated during the expansion of keloids into circumferential
skin, and that high metabolic activity of keloid tissues
(29) may be due to increased MMPs activity, which may
contribute to continuous itching and/or tenderness
associated with chronic inflammation seen in keloids
(30). Based on these hypotheses, we examined differences
in expressions of MMP-1, MMP-8, and MMP-13 between
keloid-derived fibroblasts and normal dermal fibroblasts.
Since retinoids are potent inhibitors of MMPs in the
treatment of photoaged skin and cancers as described
above, we also examined whether or not tretinoin affects
MMPs expressions of keloid derived fibroblasts.
Materials and Methods
Clinical Specimens
A total of 12 specimens of keloid (keloid group), diagnosed
on the basis of their clinical appearance, anatomic
location, etc., were excised at the Department of Plastic
and Reconstructive Surgery, the University of Tokyo
Hospital. As a control group, a total of 12 normal
skin samples, matched to the site of predilection for
keloids (scapular area, shoulder, and upper arm), were
also excised during the plastic surgery.
Part of each tissue sample was used to establish a
primary cell culture, and the rest was used for histopathologic
diagnosis. All keloid samples displayed the histopathology
diagnostic for keloids. No hypertrophic scar was included
in the materials. The clinical data of the keloid group
and the control group are shown in Table 1. No significant
difference in age between the two groups was observed
(unpaired Student's t-test; P=0.4907). All the biopsies
were taken in accordance with the Declaration of Helsinki.
Primary Dermal
Fibroblast Cultures
The primary dermal fibroblast cultures from the keloids
(n=12) and control skin samples (n=12) were established
by explant method (31). For primary culture of keloid
fibroblasts, marginal portions of keloid lesions were
used. Briefly, after removal of the reticular layer
of the dermis and epidermis from total skin samples,
the surface side of the papillary layer was attatched
to the culture dish, then the culture medium was added
and a cell culture was started (37?C, CO2 5%). Subculture
was performed 2 weeks after primary culture, when cell
culture reached to 60-70% confluence. Human fibroblasts
were isolated from the same skin specimens for explant
after they were separated from the epithelium, and
grown in FGM (Fibroblast growth medium), which consists
of Dulbecco's modified Eagle's medium (DMEM), 0.6 mg/ml
glutamine, and 10% fetal calf serum (FCS).Since the
primary culture of dermal fibroblasts contained a small
amount of keratinocytes, the passages 3 to 5 were used
for the experiment.
Measurement
of MMPs mRNA expression by real-time PCR.
Real-time reverse transcriptase polymerase chain reaction
(Real-time PCR) assays (32) on the basis of SYBR Green
Chemistry (33, 34) were performed with ABI PRISMR 7700
Sequence Detection System (PE Biosystems, Foster City,
CA) to quantify the MMP-1, MMP-8, and MMP-13 mRNA expressions.
The fibroblasts of the keloid group and normal group
were seeded at the density of 5×106 cells on a 100
mm Petri dish in 10 ml of culture medium. Forty-eight
hours after seeding, the culture medium of each dish
was changed to the medium containing 1 μM tretinoin.
Total RNA was obtained with RNeasyR Mini Kit (QIAGEN,
Hilden, Germany) as described before (35), at 0, 6,
12, 24, and 48 hours after the medium change. In order
to eliminate any residual genomic DNA, RNase-Free DNase
Set (QIAGEN, Hilden, Germany) was also applied. The
concentration of each RNA sample was measured with
Spectrophotometer V-530 UV/VIS (JASCO, Tokyo, Japan).
A reverse transcriptase reaction was performed using
RNA PCR Kit (AMV) Ver.2.1 (TaKaRa, Tokyo, Japan). Five
micro-gram of total RNA in a 100 μl of reaction mixture
(final concentrations: 5 mM MgCl2, 1 mM dNTP Mixture,
1 U/μl RNase Inhibitor, 0.125 μM Oligo dT-Adaptor Primer,
10mM Tris-HCl, 50 mM KCl, pH 8.3) containing 25 U of
AMV Reverse Transcriptase XL, was incubated at 42 ?C
for 30 minutes, followed by inactivation of the enzyme
at 99 ?C for 5 minutes with Program Temp Control System
PC-700 (ASTEC, Fukuoka, Japan). The control reaction
was performed simultaneously with an otherwise identical
reaction, but without reverse transcriptase.
Real-time PCR was performed on ABI PRISM 96-Well Optical
Reaction Plates (PE Biosystems, Foster City, CA). Sequences
of each oligonucleotide primers are shown in Table
2. All PCR reaction mixtures contained 25 μl of TaqMan
SYBRR Green PCR Master Mix (2×) (PE Biosystems, Foster
City, CA), 0.25 μl of forward primer (10 pmol/μl),
0.25 μl of reverse primer (10 pmol/μl), 4 μl of each
diluted sample, 20.5 μl of DDW per well. PCR amplification
of the identical sample was performed with both specific
primer pairs of the target MMP gene and human glyceraldehydes-3-phosphate
dehydrogenase (GAPDH) gene on the same reaction plate.
The PCR reaction was comprised of 40 cycles, consisting
of denaturing at 95 ?C (15 sec.), then annealing/extension
at 60 ?C (1 min.). In order to eliminate the possibility
of contamination of genomic DNA during extraction of
total RNA, the RNA extract before reverse transcription
was amplified in the same way as the control, and no
amplification was detected.
Measurement
of Secreted MMPs Protein by Enzyme-Linked
Immunosorbent Assay (ELISA)
The fibroblasts derived from keloid tissue or normal
skin were seeded at the density of 5×106 cells on a
100 mm Petri dish in 10 ml of culture medium as described
above. The culture medium of each dish of the experimental
group was changed to a medium containing 1 μM tretinoin
(containing 10 μl of ethanol as a vehicle), or that
containing only 10 μl vehicle, at 48 hours after seeding.
Before assay, 2 ml of each culture supernatant was
concentrated by freeze-drying using a Freeze Dryer
FRD-mini (Asahi Technoglass, Tokyo, Japan). Freeze-dried
supernatants were dissolved in the assay buffer for
the ELISA system (0.03 M H3PO4, 0.1M NaCl 1 % bovine
serum albumin, 0.01 M EDTA). For MMP-1 assay, 10× concentrated
samples were prepared, and for MMP-8 and MMP-13, 20×
concentrated samples were prepared.
The culture supernatant of each dish was collected
96 hours after the medium change. BIOTRAK ELISA MMP-1,
MMP-8, and MMP-13 System (Amersham Pharmacia Biotech,
Buckinghamshire, U.K.) was used for measurement of
MMP-1, MMP-8, and MMP-13 protein levels in each culture
supernatant, respectively. Standard and concentrated
samples (10×) were incubated in microtiter wells precoated
with a primary mouse anti-human MMP-1 monoclonal antibody
followed by a secondary rabbit anti-human MMP-1 polyclonal
antibody. The resulting antigen-antibody complex was
detected using horseradish peroxidase (HRP)-labeled
donkey anti-rabbit IgG, and the conjugate was quantified
by a colorimetric reaction with 3,3',5,5'-tetramethylbenzidine
(TMB) substrate. After stopping the reaction with 100
μl of 1 M sulphilic acid, the resultant color was read
at 450 nm with Microplate Reader Model 550 (Bio-Rad
Laboratories, Hercules, CA). All samples were assayed
in duplicate, and the concentration of the target protein
in each sample was determined by interpolation from
the standard curve.
Statistical
Analysis
All data are presented as mean ± standard error. The
data were statistically analyzed using Student's t-test.
Differences in the keloid group and in the normal group
were tested using a paired t-test. Differences between
the keloid group and the control group were tested
using an unpaired t-test. A value of p<0.05 was
considered significant.
Results
MMPs mRNA expressions in keloid-derived fibroblasts
and normal-skin-derived fibroblasts.
MMP-1, MMP-8, and MMP-13 mRNA expressions in the keloid
group and the control group were measured by real-time
PCR system, and the results are demonstrated in Fig.
1.
The normalized MMP-1 mRNA expression (MMP-1/GAPDH)
was significantly downregulated in keloid-derived fibroblasts
compared to normal fibroblasts (p=0.0001), and the
fold change versus the average of the control group
was 0.32 ± 0.02 (mean ± standard error). Similarly,
the normalized MMP-8 mRNA expression was significantly
downregulated in keloid-derived fibloblasts (p=0.0120),
and the fold change versus the average of the control
group was 0.29 ± 0.02. However, the normalized MMP-13
mRNA expression was significantly elevated in keloid-derived
fibroblasts (p<0.0001), and the fold change versus
the average of the control group was 21.21 ± 1.24.
Effects of tretinoin
on MMPs mRNA expressions in keloid-derived
fibroblasts and normal-skin-derived fibroblasts.
Effects of tretinoin on MMP-1, MMP-8, and MMP-13 mRNA
expressions over time were also examined by real-time
PCR system, and the results are shown in Fig. 2.
MMP-1 mRNA expression in the control group was significantly
upregulated with the peak at 12 hours after addition
of tretinoin (2.03 ± 0.03) (p<0.0001), whereas
no significant change was observed in the keloid group
within 24 hours after the addition of tretinoin. MMP-8
mRNA expression in the control group was significantly
upregulated with the peak at 12 hours (250.80 ± 4.98)
(p<0.0001), while no significant change was observed
in the keloid-derived fibroblasts after treatment with
tretinoin. In contrast, remarkably elevated MMP-13
mRNA expression in the keloid group was significantly
suppressed with the peak at 12 hours by tretinoin (1.29
± 0.04) (p=0.0003). MMP-13 mRNA expression in the control
group was not significantly changed by treatment with
tretinoin.
MMPs protein
levels in the culture supernatants and
effects of tretinoin on them
MMP-1, MMP-8, and MMP-13 protein levels in the culture
supernatants in the keloid group and the control group,
and effects of tretinoin on them were examined by ELISA.
The results are shown in Fig. 3.
MMP-1 protein expression was significantly lower in
the keloid group (1.04 ± 0.03 ng/ml) than in the control
group (6.16 ± 0.10 ng/ml) (p<0.0001). Similarly,
the MMP-8 protein level was significantly lower in
the keloid group (11.54 ± 0.24 pg/ml) than in the control
group (15.36 ± 0.29 pg/ml) (p=0.0043). However, the
MMP-13 protein level was significantly elevated in
the keloid group (17.53 ± 0.33 pg/ml) in contrast with
the control group (6.71 ± 0.10 pg/ml) (p<0.0001).
In both the keloid group and the control group, the
MMP-1 protein level was significantly elevated (3.35
± 0.07 ng/ml, 8.22 ± 0.09 ng/ml) (p<0.0001, p=0.0019)
by tretinoin treatment for 96 hours. Additionally,
both in the keloid group and the control group, MMP-8
protein level was significantly elevated (21.21 ± 0.22
pg/ml, 30.13 ± 0.37 pg/ml) (p<0.0001, p<0.0001)
by 96 hours' treatment with tretinoin. However, the
remarkably elevated MMP-13 protein level in the keloid
group was significantly decreased after treatment with
tretinoin for 96 hours (8.56 ± 0.20 pg/ml) (p<0.0001).
The MMP-13 protein level in the control group was modestly
suppressed by tretinoin (6.23 ± 0.08 pg/ml) (p=0.0415).
Discussion
MMP-1, MMP-8, and MMP-13 all degrade type I and type
III collagen. Among the three MMPs, MMP-1 and MMP-8
most effectively degrade type III and type I collagen,
respectively. The decrease in MMP-1 and MMP-8 may partly
contribute to the accumulation of type I and type III
collagen in keloid tissues, and this mechanism may
be modulated by molecular interaction with MMP-13.
MMP-13 is an abnormal collagenase subtype that has
been found in the bottom of chronic ulcers, where angiogenesis
and fibrosis occur (36). On the other hand, MMP-1 and
MMP-8 are considered to be "normal" collagenase
subtypes that appear in normal wound healing process
(12, 37). Before the discovery of MMP-13, reports had
shown rather conflicting results concerning to the
collagenase activity to degrade type I or total collagen
in keloid tissues: some reports had shown normal (8),
or decreased (9), and others showed increased (10)
activity of collagenase. These variable results may
be partly due to different portions of keloid tissue,
for example, a marginal portion or a central portion.
In our preliminary study, MMP-13 mRNA expression was
found to be markedly higher in marginal portions than
central portions of keloid tissues (data not shown).
In the present study, comparison of MMPs expression
was performed using a marginal portion of each keloid
sample.
Our study has demonstrated a significant increase in
MMP-13 expression as well as a decrease in expressions
of MMP-1 and MMP-8 in keloid-derived fibroblasts, both
in mRNA and protein levels. The remodeling of the surrounding
matrix by MMP-13 may interfere in normal degrading
process of wound healing in keloid tissues, and may
initiate the negative feedback mechanism to transcriptions
of MMP-1 and MMP-8, which act in the normal wound healing
process. These mechanisms could be related to chronic
inflammation and infiltration into circumferential
normal skin seen in keloid tissues.
To correct the abnormal wound healing mechanism mentioned
above, we assumed that retinoids are potent additives,
and then investigated the influences of tretinoin on
abnormal MMP expressions of keloid tissues. The present
study revealed that addition of tretinoin to the culture
media caused significant downregulation of MMP-13 in
keloid-derived fibroblasts at both levels of mRNA and
protein, and significant upregulation of MMP-8 in normal
dermal fibroblasts. Although mRNA expression of MMP-1
was not clearly affected in the keloid-derived fibroblasts
by treatment of tretinoin, upregulation of MMP-1 and
MMP-8, and downregulation of MMP-13 at the protein
level, may suggest that tretinoin reverses the specific
changes in the MMPs expression profile of keloids.
We also examined mRNA expressions of four subtypes
of TIMP (TIMP-1, -2, -3, and -4). All of these subtypes
were upregulated in keloid-derived fibroblats, but
we did not detect any significant changes after treatment
with tretinoin (data not shown).
A small number of past literatures reported effects
of retinoids on primary cultured human dermal fibroblasts.
Daly et al. (38) demonstrated that tretinoin significantly
reduces collagen production of human primary cultured
fibroblasts. Abergel et al. (39) reported that tretinoin
and isotretinoin significantly inhibit degradation
activity of type I collagen fibers in keloid-derived
fibroblasts. On the other hand, in the field of cancer
cell study, degradation of type I and type IV collagen,
and invasion into collagen matrix was reported to be
significantly inhibited by retinoids (28). The results
of our study and those in the literature suggest that
a remarkable inhibition of degradation of type I collagen
by tretinoin is presumably due to a strong inhibition
of MMP-13 expression by tretinoin, which negates the
upregulation of MMP-8.
Expressions of MMP-1 and MMP-13 are known to be induced
at transcriptional level by a variety of growth factors
(14), and these extracellular stimuli result in activation
of nuclear AP-1 trascription factor complex, which
binds to the AP-1 cis-regulatory element in the promoter
region of MMP gene and potently activates transcription
of the corresponding MMP gene (15). This AP-1-dependent
activation of inducible MMPs is potently inhibited
by glucocorticoids (17) and tretinoin (18) at transcriptional
level. The present results revealed that MMP-13 was
upregulated in keloid-derived fibloblasts and this
upregulation of MMP-13 was inhibited at the transcription
level by tretinoin, suggesting this upregulation of
MMP-13 in keloids is induced via the AP-1 pathway.
However, exactly how tretinoin upregulates MMP-1 and
MMP-8 in keloid-derived fibroblasts, as well as in
normal dermal fibroblasts, remains unknown. Further
investigations of the regulations are necessary to
clarify the mechanism.
In this study, it is suggested that MMPs are abnormally
regulated in keloid tissues as well as chronic ulcers,
and that these abnormal changes may be reversed by
treatment with retinoids. Tretinoin may improve chronic
inflammation seen in keloids and prevent expansion
of keloid tissues into circumferential normal skin.
Since 1999, we have been performing clinical trials
with tretinoin aqueous gel (0.1-0.4%) for treatment
of keloids. Our preliminary results demonstrated that
topical application of tretinoin on keloids has unique
advantages. In most cases, itching and/or tenderness
of the lesions disappeared after topical tretinoin
(in preparation), although the volume-suppressing effects
on the fibrosis was quite modest. We assume that effects
of tretinoin on MMPs expression resulted in suppression
of chronic inflammation and prevention of growth and
invasion of keloid tissues. In considering limited
clinical improvements and side effects of existing
techniques, the clinical use of topical tretinoin looks
promising. Thus, molecular mechanisms of the regulation
of MMPs deserve further investigation. The results
of this study may be helpful to develop more chemically
stable synthesized retinoids, which specifically reverse
abnormal expressions of MMPs and prevent cell growth
in keloids with minimal side effects.
Legends
Table 1. Profiles
of skin samples used in the experiment
control group number: 12
(normal skin) age: 17-51yrs. (32.8 ± 9.5 yrs.*)
sex: male: 6, female: 6
sites: scapular region: 9 ,
upper arm: 2, shoulder: 1
keloid group number: 12
age: 8-58 yrs. (29.0 ± 15.9 yrs.*)
sex: male: 5, female: 7
sites: scapular region: 4,
shoulder: 2, upper arm: 2,
chest: 2, forearm: 1, ear: 1
*: mean ± SD. No significant difference was observed
between the control group and the keloid group (p=0.4907).
Table 2. Oligonucleotid primers used in the real-time
PCR amplification of MMPs.
Gene Primer
sequence*
Human MMP-1
ACGGATACCCCAAGGACATCT
CTCAGAAAGAGCAGCATCGATATG
Human MMP-8
ACCAAAGAGATCACGGTGACAA
TGAGCATCTCCTCCAATACCTTG
Human MMP-13
CCTGGAGCACTCATGTTTCCTAT
GACTGGATCCCTTGTACATCGTC
Human GAPDH#
GAAGGTGAAGGTCGGAGTC
GAAGATGGTGATGGGATTTC
*: All primer
sequences are written from 5' to 3'. For
each primer pair, the top sequence is sense
and the bottom sequence is antisense. #:
GAPDH is human glyceraldehyde-3-phosphate
dehydrogenase and was used as a housekeeping
gene.
|
